View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18266_low_15 (Length: 238)
Name: NF18266_low_15
Description: NF18266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18266_low_15 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 11179379 - 11179600
Alignment:
| Q |
18 |
ttgttttcttcttcaagttgattagggaccgtagaagctccctaataataattgtgtcaaa-gttttttaatgtgttatgtcataatgttattttctaaa |
116 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11179379 |
ttgttttgttcttcaagttgattggggaccgtagaagctccctaataatatttgtgtcaaaagttttttaatgtgttatgtcataatgttattttctaaa |
11179478 |
T |
 |
| Q |
117 |
atacttatacaagtatttatatgttaaatatgattgaatgtctgcatgaaattcttttatattgtcaagaatggagcgagaaacttgtttaaaaaagaaa |
216 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11179479 |
atacttattcaagtatttatatgttaaatatgattgaatgtctgcatgaaattcttttatattgtcaagaatggagcgagaaacttgtttaaaaaagaaa |
11179578 |
T |
 |
| Q |
217 |
tagcaaaacatatagaacaccc |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
11179579 |
tagcaaaacatatagaacaccc |
11179600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University