View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18267_low_1 (Length: 364)
Name: NF18267_low_1
Description: NF18267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18267_low_1 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 6 - 346
Target Start/End: Complemental strand, 12634393 - 12634055
Alignment:
| Q |
6 |
acataattcttgcatcctagtgtaatttttacctgatttttcacagctaaacaccaacttcagtgccaagtgtggtgataccttggaaattagctgttta |
105 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12634393 |
acataattcttgcatcctagtgtattttttacctgatttttcacagctaaacactaacttcggtgccaagtgtggtgataccttggaaattagctgttta |
12634294 |
T |
|
| Q |
106 |
ttaatctatgaaattttattcctaccatgggattgctagatgcatatttacaatttccaatctgcatcaaccattaaattggtcttatatcctatgtttt |
205 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| ||| |
|
|
| T |
12634293 |
ttaatctatgaaattttattcctaccgtgggattgctagatgcatatttacaatttccaatctgcatcaa-cattaaaatggtcttatatcctatg-ttt |
12634196 |
T |
|
| Q |
206 |
taaaaattgaactagacgactcaaccaattgaactttaaatcggtagcatctacggttcagttatttgaatggtttggtcacatttttcctttcgattca |
305 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12634195 |
taaaaattaaactagacgattcaaccaattgaactttaaaccggtagcatctacggttcagttatttgaatggtttgatcacatttttcctttcgattca |
12634096 |
T |
|
| Q |
306 |
agcgttttaaagcaattgaactatgaattagaagtattgtc |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12634095 |
agcgttttaaagcaattgaactatgaattagaagtattgtc |
12634055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 145 - 190
Target Start/End: Complemental strand, 32367932 - 32367887
Alignment:
| Q |
145 |
atgcatatttacaatttccaatctgcatcaaccattaaattggtct |
190 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||| ||| |||||| |
|
|
| T |
32367932 |
atgcatatttacaatctccaatctgcaccaaccatcaaaatggtct |
32367887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University