View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18267_low_3 (Length: 258)
Name: NF18267_low_3
Description: NF18267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18267_low_3 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 19 - 258
Target Start/End: Complemental strand, 3309034 - 3308796
Alignment:
| Q |
19 |
aacgtgctaatacatatacagaaaatatatcaattaagatgattgttaat-gtcagagataaatgatagataccagatactaaagttgtttaatttgtga |
117 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3309034 |
aacgtgctaatacatatatagaaaatatatcaattgagatgattgttaatcgtcagagataaatgatagataccagatactaaagttgtttaatctgtga |
3308935 |
T |
 |
| Q |
118 |
tttatgatttgctcgtcggagtgtatacataaaaaacatatgctagtttgagtttggatactcaaactaannnnnnnnnnnnnnnnatatactccaaaac |
217 |
Q |
| |
|
||||||||||| || || |||||||||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
3308934 |
tttatgatttgatcttcacagtgtatacataaaaaacatatgctactttgagtttggatactc--actaattttttaattttttttatatactccaaaac |
3308837 |
T |
 |
| Q |
218 |
ggcatcgttttgttaccttaacgtctacgtagttggaatcc |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3308836 |
ggcatcgttttgttaccttaacgtctacgtagttggaatcc |
3308796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University