View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18268_low_11 (Length: 264)
Name: NF18268_low_11
Description: NF18268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18268_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 10 - 169
Target Start/End: Original strand, 52762157 - 52762316
Alignment:
| Q |
10 |
gcataggttctgatcgcaaaagatccattgtgggagaataataacgttaactttgcatttggattttaaaattggaatgaataagggaagaatgcatggc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52762157 |
gcataggttctgatcgcaaaagatccattgtgggagaataataacgttaactttgcatttggattttaaaattggaatgaataagggaagaatgcatggc |
52762256 |
T |
|
| Q |
110 |
ctgaatatgctattatcaaactcaaatcatgccactacttccatcttgcggcataaaatg |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52762257 |
ctgaatatgctattatcaaactcaaatcatgccactacttccatcttgcggcataaaatg |
52762316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University