View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18268_low_7 (Length: 335)
Name: NF18268_low_7
Description: NF18268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18268_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 190 - 325
Target Start/End: Complemental strand, 18322658 - 18322526
Alignment:
| Q |
190 |
ggattaaaactaagatgttttgttctaagcccttcaccacaaccatgttcatatttttatttctctttaccttgctaatcaaaactttaacagctacaac |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| | |||||||||||||||||||||||| ||| |||| ||||||||| ||||||||||| |
|
|
| T |
18322658 |
ggattaaaactaagatgttttgttctaagcccttcaacactatcatgttcatatttttatttctcttaaccatgctgatcaaaact---acagctacaac |
18322562 |
T |
|
| Q |
290 |
aagcactgtaattagtccaactacattctccttcat |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
18322561 |
aagcactgtaattagtccaactacattctccttcat |
18322526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 18 - 59
Target Start/End: Complemental strand, 18322816 - 18322775
Alignment:
| Q |
18 |
atatctaatctaataaatcaacaattagcatatatttgattc |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18322816 |
atatctaatctaataaatcaacaattagcatatatttgattc |
18322775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University