View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18269_low_2 (Length: 728)
Name: NF18269_low_2
Description: NF18269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18269_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 1e-83; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 1e-83
Query Start/End: Original strand, 378 - 535
Target Start/End: Complemental strand, 56312079 - 56311922
Alignment:
| Q |
378 |
ccaggaagttcccaagggtcatagcgataaagatcgagaaaagtaataagctcaacgttgaaacgttttccctcgaccttacggcgaaggtagaactcta |
477 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56312079 |
ccaggaagttcccaagggtcatagcgataaagatcgagaaaagtaataagctcaacgttgaaacgttttccctcgaccttacggcgaaggtagaactcta |
56311980 |
T |
 |
| Q |
478 |
caagttcttcttcagttggatggaaacgaaaccctggcataaccacgtcatgctcgtg |
535 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56311979 |
caagttcttcttcagttggatggaaacgaaaccctggcataaccacgtcatgctcgtg |
56311922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 146; E-Value: 2e-76
Query Start/End: Original strand, 557 - 702
Target Start/End: Complemental strand, 56311894 - 56311749
Alignment:
| Q |
557 |
tactactgtaactgtagctgtagctcctttgttaatattatcgttagaagttccatcttcgtgactcaagctcatgctgctcatgttaggtgatgatgtt |
656 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56311894 |
tactactgtaactgtagctgtagctcctttgttaatattatcgttagaagttccatcttcgtgactcaagctcatgctgctcatgttaggtgatgatgtt |
56311795 |
T |
 |
| Q |
657 |
gctgctgctattgccatccactctctctaactaactaacaacaaca |
702 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56311794 |
gctgctgctattgccatccactctctctaactaactaacaacaaca |
56311749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 19 - 147
Target Start/End: Complemental strand, 56312405 - 56312280
Alignment:
| Q |
19 |
gattgctgccaaagctgctcatcatcatcatatgcaattcatatatatcaaattcaatcacataactaaatatataacagcttcata---tcatattttc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
56312405 |
gattgctgccaaagctgctcatcatcatcat---ca--tcatc-atatcaaattcaatcacataactaaatatataacagcttcatatcatcatatttgc |
56312312 |
T |
 |
| Q |
116 |
gtatgtatgtgaagtgaattattaaattaaat |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
56312311 |
gtatgtatgtgaagtgaattattaaattaaat |
56312280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 265 - 331
Target Start/End: Complemental strand, 56312189 - 56312123
Alignment:
| Q |
265 |
taaatcaaagagggatggcaacnnnnnnnngggtttccagaattgctttaggaaaggggaagttctc |
331 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56312189 |
taaatcaaagagggatggcaacaaaaaaaagggtttccagaattgctttaggaaaggggaagttctc |
56312123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 477 - 514
Target Start/End: Complemental strand, 8449761 - 8449724
Alignment:
| Q |
477 |
acaagttcttcttcagttggatggaaacgaaaccctgg |
514 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
8449761 |
acaagttcttcatcagttgggtggaaacgaaaccctgg |
8449724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University