View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18269_low_20 (Length: 268)
Name: NF18269_low_20
Description: NF18269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18269_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 264
Target Start/End: Original strand, 31951422 - 31951685
Alignment:
| Q |
1 |
ttttaactttattgctgatgatgtatcatccgtcgaaagaaaaggttcaagcaacaaatctttcgctgacggtctatttgccgcaggttctaaacatttt |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31951422 |
ttttaacttcattgctgatgatgtatcatctgtcgaaagaaaaggttcaagcaacaaatctttcgctgacggtctatttgccgcaggttctaaacatttt |
31951521 |
T |
 |
| Q |
101 |
ccaatgaatctccgcgcttccccatcttcaatgcggaaaaatgacattggtagcttcccctaaaacagaaatgttacttaatcaaacatcaaattttact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31951522 |
ccaatgaatctccgcgcttccccatcttcaatgcggaaaaatgacattggtagcttcccctaaaacagaaatgttacttaatcaaacatcaaattttact |
31951621 |
T |
 |
| Q |
201 |
gatatcatgagatctaaaccagaacgtgaatttaccgatgtcactttcttgtatatctgtgctg |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31951622 |
gatatcatgagatctaaaccagaacgtgaatttaccgatgtcactttcttgtatatctgtgctg |
31951685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 229 - 262
Target Start/End: Original strand, 5951513 - 5951546
Alignment:
| Q |
229 |
aatttaccgatgtcactttcttgtatatctgtgc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
5951513 |
aatttaccgatgtcactttcttgtatatttgtgc |
5951546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University