View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18269_low_26 (Length: 220)
Name: NF18269_low_26
Description: NF18269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18269_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 23 - 202
Target Start/End: Original strand, 12919689 - 12919873
Alignment:
| Q |
23 |
ggcatacaggatcaagattcacgcctttttgttccagtcgccctctggttggcagaatgtcgcgggccagtcgccacaaaaagtttctagt-----acag |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| | | |
|
|
| T |
12919689 |
ggcatacaggatcaagaatcacgcctttttgttccagtcggcctctggttggcagaatgttgcgggccagtcgccacaaaaagtttctagtcctagcctg |
12919788 |
T |
|
| Q |
118 |
tttggagcatgcattttccagactgctctccaaagcctttggtcaatcatagaagaagcttcagggttctctctactgttgtcat |
202 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| ||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12919789 |
tttggagcatgcattttccagtctgctctccaaagcctttggtcactcaaagatgaagcttcagggttctctctactgttgtcat |
12919873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University