View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18269_low_27 (Length: 219)

Name: NF18269_low_27
Description: NF18269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18269_low_27
NF18269_low_27
[»] chr2 (2 HSPs)
chr2 (28-203)||(24586512-24586687)
chr2 (28-67)||(44487822-44487861)
[»] chr1 (1 HSPs)
chr1 (26-61)||(34698102-34698137)


Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 28 - 203
Target Start/End: Complemental strand, 24586687 - 24586512
Alignment:
28 catataataatgcatgtccctttcaactgagctaaactcagagggacaaaatattaactttttatttacaatagagaggagataaactattaaaagcagt 127  Q
    |||| ||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24586687 catacaataatgcatgtccctttcaactgagctaaactcacaggaacaaaatattaactttttatttacaatagagaggagataaactattaaaagcagt 24586588  T
128 gatgtgtagcaaatannnnnnncatcatatattttgatactgcagccaatgttctctgggttctctttggttagtg 203  Q
    |||||||||||||||       |||||||||||||||||||||||||||| |||||||||||||||||||||||||    
24586587 gatgtgtagcaaatatttttttcatcatatattttgatactgcagccaattttctctgggttctctttggttagtg 24586512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 67
Target Start/End: Original strand, 44487822 - 44487861
Alignment:
28 catataataatgcatgtccctttcaactgagctaaactca 67  Q
    ||||||||||||||||||||| |||||||||||| |||||    
44487822 catataataatgcatgtccctatcaactgagctatactca 44487861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 26 - 61
Target Start/End: Complemental strand, 34698137 - 34698102
Alignment:
26 tacatataataatgcatgtccctttcaactgagcta 61  Q
    ||||||||||||||||||||||| ||||||||||||    
34698137 tacatataataatgcatgtccctgtcaactgagcta 34698102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University