View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18269_low_27 (Length: 219)
Name: NF18269_low_27
Description: NF18269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18269_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 28 - 203
Target Start/End: Complemental strand, 24586687 - 24586512
Alignment:
| Q |
28 |
catataataatgcatgtccctttcaactgagctaaactcagagggacaaaatattaactttttatttacaatagagaggagataaactattaaaagcagt |
127 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24586687 |
catacaataatgcatgtccctttcaactgagctaaactcacaggaacaaaatattaactttttatttacaatagagaggagataaactattaaaagcagt |
24586588 |
T |
 |
| Q |
128 |
gatgtgtagcaaatannnnnnncatcatatattttgatactgcagccaatgttctctgggttctctttggttagtg |
203 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24586587 |
gatgtgtagcaaatatttttttcatcatatattttgatactgcagccaattttctctgggttctctttggttagtg |
24586512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 67
Target Start/End: Original strand, 44487822 - 44487861
Alignment:
| Q |
28 |
catataataatgcatgtccctttcaactgagctaaactca |
67 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
44487822 |
catataataatgcatgtccctatcaactgagctatactca |
44487861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 26 - 61
Target Start/End: Complemental strand, 34698137 - 34698102
Alignment:
| Q |
26 |
tacatataataatgcatgtccctttcaactgagcta |
61 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34698137 |
tacatataataatgcatgtccctgtcaactgagcta |
34698102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University