View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18270_high_14 (Length: 300)
Name: NF18270_high_14
Description: NF18270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18270_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 30 - 231
Target Start/End: Original strand, 46901305 - 46901506
Alignment:
| Q |
30 |
tcaacgtgaggaggagaagattaagatgggagatgttctgaccggagcaacagcgaagctgccagctgataaggcggcgacaaggcaagatgctgctggg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46901305 |
tcaacgtgaggaggagaagattaagatgggagatgttctgaccggagcaacagcgaagctgccagctgataaggcggcgacaaggcaagatgctgctggg |
46901404 |
T |
|
| Q |
130 |
gtggctagtgctgagatgaggaataatcctgatgctactgctactcctggtggtgtagctgcttctgttgctgcggctgctaggctcaatgaaaacgtgg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46901405 |
gtggctagtgctgagatgaggaataatcctgatgctactgctactcctggtggtgtagctgcttctgttgctgcggctgctaggctcaatgaaaacgtgg |
46901504 |
T |
|
| Q |
230 |
gc |
231 |
Q |
| |
|
|| |
|
|
| T |
46901505 |
gc |
46901506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University