View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18271_high_21 (Length: 218)
Name: NF18271_high_21
Description: NF18271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18271_high_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 157 - 211
Target Start/End: Original strand, 27903957 - 27904011
Alignment:
| Q |
157 |
tgtaacaaagccataaagatttggtttggaaaatatgaattttttcatattcttc |
211 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27903957 |
tgtaacaaagccataaggatttggtttggaaaatatgaattttttgatattcttc |
27904011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University