View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18271_low_16 (Length: 277)
Name: NF18271_low_16
Description: NF18271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18271_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 14988579 - 14988322
Alignment:
| Q |
1 |
taagtaaatcaggtgctgaaaattggtttgcttcatctcccaccacaaagtccaaaagtgtggcaacatttcttagtgatgaaaatgatgtggatgagct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14988579 |
taagtaaatcaggtgctgaaaattggtttgcttcatctcccaccacaaagtccaaaagtgtggcaacatttcttagtgatgaaaatgatgtggatgagct |
14988480 |
T |
|
| Q |
101 |
tgaaatgttactagaggtcattaattaacattatctttatctttaaca--tgtaagaaataatcttccattttaagttattttgaaatgctattaataag |
198 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||| ||||||| | ||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14988479 |
tgaaatgttactagaggtca----ttaacattatatttatttttaacatctataagaaataatcttccattttaaattattttgaaatgctattaataag |
14988384 |
T |
|
| Q |
199 |
tgatgttaatcattttgcaggcttattacatgcaaattgatggcactttaaatagattgtct |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14988383 |
tgatgttaatcattttgcaggcttattacatgcaaattgatggcactttcaatagattgtct |
14988322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 31 - 118
Target Start/End: Complemental strand, 14977857 - 14977770
Alignment:
| Q |
31 |
cttcatctcccaccacaaagtccaaaagtgtggcaacatttcttagtgatgaaaatgatgtggatgagcttgaaatgttactagaggt |
118 |
Q |
| |
|
|||||||||||| ||||||| |||| |||||||||||||| |||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
14977857 |
cttcatctcccatcacaaaggtcaaacgtgtggcaacatttactagtgatgaaaatgatttggaggagcttgaaatgttactagaggt |
14977770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 211 - 250
Target Start/End: Complemental strand, 33808113 - 33808074
Alignment:
| Q |
211 |
ttttgcaggcttattacatgcaaattgatggcactttaaa |
250 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
33808113 |
ttttgcaggcttatttcatgcaaattgatggcacattaaa |
33808074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 211 - 250
Target Start/End: Complemental strand, 33867582 - 33867543
Alignment:
| Q |
211 |
ttttgcaggcttattacatgcaaattgatggcactttaaa |
250 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
33867582 |
ttttgcaggcttatttcatgcaaattgatggcacattaaa |
33867543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University