View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18271_low_20 (Length: 243)
Name: NF18271_low_20
Description: NF18271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18271_low_20 |
 | |
|
| [»] scaffold0864 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 2e-67; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 13 - 154
Target Start/End: Original strand, 5331989 - 5332130
Alignment:
| Q |
13 |
aaggaagaacgagtatcctcccccttgaaacttaagaatatgtcgtgaatccttacaaattccgatattagttttggatctggttccggatctggatccc |
112 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5331989 |
aaggaagaatgagtatcctcccccctgaaacttaagaatatgtcgtgaatccttacaaattccgatattagttctggatctggttccggatctggatccc |
5332088 |
T |
|
| Q |
113 |
gttctggttctggatcaaacagctgcggatgcggatccacta |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5332089 |
gttctggttctggatcaaacagctgcggatgcggatccacta |
5332130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 13 - 98
Target Start/End: Original strand, 5264460 - 5264545
Alignment:
| Q |
13 |
aaggaagaacgagtatcctcccccttgaaacttaagaatatgtcgtgaatccttacaaattccgatattagttttggatctggttc |
98 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||| | ||| ||||||||||||||||| |||||| || |||||||||||| |
|
|
| T |
5264460 |
aaggaagaacgagtatcctctcccctgaaacttaagaacacgtcatgaatccttacaaattctgatattgcttctggatctggttc |
5264545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 13 - 110
Target Start/End: Complemental strand, 5360809 - 5360712
Alignment:
| Q |
13 |
aaggaagaacgagtatcctcccccttgaaacttaagaatatgtcgtgaatccttacaaattccgatattagttttggatctggttccggatctggatc |
110 |
Q |
| |
|
|||||||||||||||||||| ||| | ||||||||||| | ||||||||||| || | |||| |||||| ||| ||||| || || |||||| ||||| |
|
|
| T |
5360809 |
aaggaagaacgagtatcctctcccctaaaacttaagaacacgtcgtgaatccctatagattctgatattggttctggatatgatttcggatcaggatc |
5360712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 16 - 106
Target Start/End: Complemental strand, 5394233 - 5394143
Alignment:
| Q |
16 |
gaagaacgagtatcctcccccttgaaacttaagaatatgtcgtgaatccttacaaattccgatattagttttggatctggttccggatctg |
106 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||| | ||||||||||||||| ||||| | ||||||||| ||||| ||||| |||| |
|
|
| T |
5394233 |
gaagaacgagtgtcctcccctctgaaacttaagaacacgtcgtgaatccttactcgttccggttttagttttgattctggatccgggtctg |
5394143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0864
Description:
Target: scaffold0864; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 81
Target Start/End: Complemental strand, 4309 - 4241
Alignment:
| Q |
13 |
aaggaagaacgagtatcctcccccttgaaacttaagaatatgtcgtgaatccttacaaattccgatatt |
81 |
Q |
| |
|
|||| ||||||||||||| | ||| ||||||||||||| | || |||||||||||| |||| |||||| |
|
|
| T |
4309 |
aaggtagaacgagtatccactcccctgaaacttaagaacacatcatgaatccttacagattctgatatt |
4241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University