View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18271_low_23 (Length: 218)

Name: NF18271_low_23
Description: NF18271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18271_low_23
NF18271_low_23
[»] chr2 (1 HSPs)
chr2 (157-211)||(27903957-27904011)


Alignment Details
Target: chr2 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 157 - 211
Target Start/End: Original strand, 27903957 - 27904011
Alignment:
157 tgtaacaaagccataaagatttggtttggaaaatatgaattttttcatattcttc 211  Q
    |||||||||||||||| |||||||||||||||||||||||||||| |||||||||    
27903957 tgtaacaaagccataaggatttggtttggaaaatatgaattttttgatattcttc 27904011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University