View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18271_low_24 (Length: 212)
Name: NF18271_low_24
Description: NF18271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18271_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 8e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 15 - 139
Target Start/End: Original strand, 7107937 - 7108062
Alignment:
| Q |
15 |
cagagaaatggacttgaaggcaagaaggataagcatagaatctgtctccgaccaaaaatttgataaa-ctctgctacgagcaatttcaatggtcatcata |
113 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||| |||||||| || |||||||||||||||||||| |
|
|
| T |
7107937 |
cagagaaatggacttgaaggcaaaaaggataagcatagaatctgtctccgaccaaaaatttgacaaacctctgctatgaccaatttcaatggtcatcata |
7108036 |
T |
 |
| Q |
114 |
gcacctgataattcaacaaatatgat |
139 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
7108037 |
gcacctgataattcaacaaatatgat |
7108062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 139 - 193
Target Start/End: Original strand, 7108239 - 7108293
Alignment:
| Q |
139 |
taagaaatatgacaagattatactcacttttaaaactactcgataaagaggagaa |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7108239 |
taagaaatatgacaagattatactcacttttaaaactactcgataaagaggagaa |
7108293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University