View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18271_low_9 (Length: 354)
Name: NF18271_low_9
Description: NF18271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18271_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 3e-67; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 182 - 343
Target Start/End: Complemental strand, 51794356 - 51794195
Alignment:
| Q |
182 |
gactctttcaatgtgtttactctcgtcaataaaggatttacaattcattattttgcatctttttcttatgtcgacattcctcgttgcaaagatcaccctt |
281 |
Q |
| |
|
|||||||| ||||| ||||||||| ||||||||| |||||| | |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51794356 |
gactctttgaatgtatttactctcatcaataaagaatttacgactcattattttgcatgtttttcttatgtcgacattcctcgttgcaaagatcaccctt |
51794257 |
T |
|
| Q |
282 |
ttaaaggttaaatgtagttttgacccaccaaaggttaaaacgtgattccatcatctcttctt |
343 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
51794256 |
ttaaaggttaaatgtagttttgacccatcaaaggttaaaacgtgattccatcatctcttctt |
51794195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 56 - 119
Target Start/End: Complemental strand, 51794482 - 51794419
Alignment:
| Q |
56 |
ttattcctatttataataggcctttataatattattaacaacctaatctttgattattatcaac |
119 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51794482 |
ttattcccatttataatagacctttataatattattaacaacctaatctttgattattatcaac |
51794419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 51794536 - 51794506
Alignment:
| Q |
1 |
aattattaaagtctaagttagtaagtgtgta |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
51794536 |
aattattaaagtctaagttagtaagtgtgta |
51794506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University