View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18272_high_18 (Length: 348)
Name: NF18272_high_18
Description: NF18272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18272_high_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 9e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 14 - 132
Target Start/End: Original strand, 6992424 - 6992542
Alignment:
| Q |
14 |
gcagagatcaagaagaggaagaagtgctagaggtggtagtgctggtgttgagaagtttacggcgttgttgagttctataccggagtaggggtagtttcgg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6992424 |
gcagagatcaagaagaggaagaagtgctagaggtggtagtgctggtgttgagaagtttacggcgttgttgagttctataccggagtaggggtagtttcgg |
6992523 |
T |
|
| Q |
114 |
aaaaaatggttcatggtga |
132 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
6992524 |
aaaaaatggttcatggtga |
6992542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 179 - 325
Target Start/End: Original strand, 6992590 - 6992728
Alignment:
| Q |
179 |
gatgtagatttagattcttttgattggagttggaccaagtcgtaattggaatttggatattccgttaaactgtctctttattaaacttttctccgttttt |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6992590 |
gatgtagatttagattcttttgattggagttggaccaagtcgtaattggaatttggatattccgttaaactgtctctttattaaact--------ttttt |
6992681 |
T |
|
| Q |
279 |
atttttagtcgatgcattttacacacaactacatagcttaatctatt |
325 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6992682 |
ctttttaatcgatgcattttgcacacaactacatagcttaatctatt |
6992728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University