View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18272_low_23 (Length: 291)
Name: NF18272_low_23
Description: NF18272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18272_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 157 - 282
Target Start/End: Original strand, 43292367 - 43292492
Alignment:
| Q |
157 |
accatcgggtccgcctacgctgtcatccaccacaaaatctatctcatcggtggttccgtcaacgatgtaccctctcgtcatgtatggatccttgattgcc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43292367 |
accatcgggtccgcctacgctgtcatccaccacaaaatctatctcatcggtggttccgtcaacgatgtaccctctcgtcatgtatggatccttgattgcc |
43292466 |
T |
 |
| Q |
257 |
gattccaccggtggctctctgctcct |
282 |
Q |
| |
|
||||||||||||||||| ||| |||| |
|
|
| T |
43292467 |
gattccaccggtggctccctggtcct |
43292492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University