View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18272_low_33 (Length: 230)
Name: NF18272_low_33
Description: NF18272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18272_low_33 |
 |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 32650829 - 32650614
Alignment:
| Q |
1 |
tctttcattcgttcatctctctccaccgctctcatctgcttcttcgatggatctcagcatctcaattcgtttactctttcctttcatttatttgcattat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32650829 |
tctttcattcgttcatctctctccaccgctctcatctgcttcttcgatcgatctcagcatctcaattcgtttactctttcctttcatttattttcattat |
32650730 |
T |
 |
| Q |
101 |
cgccgtgataaatggatcagaattgttctgatatttacacaaatataaacaaacccctcatgaaatgatttcagtacgttaatcattatgattgttcacg |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32650729 |
ggccgtgatgaatggatcagaattgttctgatatttacacaaatataaacaaacccctcatgaaatgatttca----gttaatcattatgattgttcacg |
32650634 |
T |
 |
| Q |
201 |
ttctggtactttttcctttg |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
32650633 |
ttctggtactttttcctttg |
32650614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 84
Target Start/End: Original strand, 5080091 - 5080153
Alignment:
| Q |
23 |
ccaccgctctcatctgcttcttcgatggatctca-gcatctcaattcgtttactctttccttt |
84 |
Q |
| |
|
|||| |||||||||||||||||| || ||||||| | |||||||||| | ||||||||||||| |
|
|
| T |
5080091 |
ccactgctctcatctgcttcttctatcgatctcatgtatctcaattcctatactctttccttt |
5080153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 65
Target Start/End: Original strand, 33854332 - 33854374
Alignment:
| Q |
23 |
ccaccgctctcatctgcttcttcgatggatctcagcatctcaa |
65 |
Q |
| |
|
||||| ||||||||||||||||| || |||||||||||||||| |
|
|
| T |
33854332 |
ccaccactctcatctgcttcttcaatcgatctcagcatctcaa |
33854374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 84
Target Start/End: Complemental strand, 208090 - 208034
Alignment:
| Q |
29 |
ctctcatctgcttcttcgatggatctca-gcatctcaattcgtttactctttccttt |
84 |
Q |
| |
|
||||||||||||||||| || ||||||| | |||||||||| | ||||||||||||| |
|
|
| T |
208090 |
ctctcatctgcttcttctattgatctcaggtatctcaattcctatactctttccttt |
208034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University