View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18273_high_17 (Length: 307)
Name: NF18273_high_17
Description: NF18273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18273_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 5 - 271
Target Start/End: Complemental strand, 2731301 - 2731035
Alignment:
| Q |
5 |
ccatatgggttttttaaaaggcgagaaatgcacacccgacaaggaggaaagggtatgtgcataatcttgatcaggttaccatccccttcttcttcagtaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2731301 |
ccatatgggttttttaaaaggcgagaaatgcacacccgacaaggaggaaaggttatgtgaataatcttgatcaggttaccatccccttcttcttcactaa |
2731202 |
T |
 |
| Q |
105 |
cttctaggatgaggtaaaaatgataagagttatggaaactttttgctaaatatgggaggtggggaaagtctatattactcaaaagagggatcaatgaggg |
204 |
Q |
| |
|
||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2731201 |
cttttaagatgaggtaaaaatgataagagttatggaaactttttgctaaatatgggaggtggggaaagtctatattcctcaaaagagggatcaatgaggg |
2731102 |
T |
 |
| Q |
205 |
agaaaatatgactttgtgatgtttaaggaggtgaacaatgaagaggagcttgaaaagaggctggggg |
271 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2731101 |
agaaaatatgattttgtgatgtttaaggaggtgaacaatgaagaggagcttgaaaagaggctggggg |
2731035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University