View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18275_low_10 (Length: 255)
Name: NF18275_low_10
Description: NF18275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18275_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 10088565 - 10088338
Alignment:
| Q |
1 |
tttccgctacccacagttaacgacactgatggaacacaatattctcatttgtaaattgtcatctaaaatacatcaaagttgcacaacaacttcatgatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10088565 |
tttccgctacccacagttaacgacactgatggaacacaatattctcatttgtaaattgtcatctaaaatacatcaaagttgcacaacaacttcatgatga |
10088466 |
T |
 |
| Q |
101 |
ataagcatcagttccaaaaccccttattgaaaggaaaccacgagggctcacttggttgatatgtgcaaagtatgaagatacaaaaatagaggagaaaata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10088465 |
tcaagcatcagttccaaaaccccttattgaaaggaaaccacgagggctcacttggttgatatgtgcaaagtatgaagatacaaaaatagaggataaaata |
10088366 |
T |
 |
| Q |
201 |
aaatgagtttccataaaatatattattatc |
230 |
Q |
| |
|
|| ||||||||||| |||||||||||||| |
|
|
| T |
10088365 |
aa--gagtttccatacaatatattattatc |
10088338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University