View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18275_low_17 (Length: 235)
Name: NF18275_low_17
Description: NF18275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18275_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 2 - 222
Target Start/End: Original strand, 31786389 - 31786615
Alignment:
| Q |
2 |
acttttattcataactaattttaaaaaatcaatttatgtcactccaaatatgatgggctgg-----caaaaacatcactatctatctatctataattgat |
96 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31786389 |
acttttattcataactaatttaaaaaaatcaatttatgtcactcgaaatatgatgggctggttcttcaaaaacatcactatctatctatctataattgat |
31786488 |
T |
 |
| Q |
97 |
aaaagtaacccatactttgatataactattttgag-nnnnnnnncttcttgacattaattgaattaagtttctgataaactactatctcatttaagttcc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31786489 |
aaaagtaacccatactttgatataactattttgagttttttcttcttcttgacattaactgaattaagtttctgataaactactatctcatttaagttcc |
31786588 |
T |
 |
| Q |
196 |
atatatgtctctatctgagttaaaagt |
222 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
31786589 |
atatatgtctctatctgagttaaaagt |
31786615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University