View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18275_low_18 (Length: 227)
Name: NF18275_low_18
Description: NF18275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18275_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 20 - 214
Target Start/End: Original strand, 5810165 - 5810357
Alignment:
| Q |
20 |
atgaatgtagcataattaacttttttcttctacatatgtttgccnnnnnnnnnnnnnnggcgtaagaatattttcttggtctgattttctgtcaatagat |
119 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5810165 |
atgaatgtagcttaaataacttttttcttctacatatgtttgcctttttttttttt--ggcgtaagaatattttcttggtctgattttctgtcaatagat |
5810262 |
T |
|
| Q |
120 |
ggataagattgcgttggtttgtctgttttataatacggaatgattcatgttataagaatgaagcaactaataaagaaaacggggggaaaatgtga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5810263 |
ggataagattgcgttggtttgtctgttttataatacagaatgattcatgttataagaatgaagcaactaataaagaaaacggggggaaaatgtga |
5810357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University