View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18276_high_15 (Length: 261)
Name: NF18276_high_15
Description: NF18276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18276_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 13 - 245
Target Start/End: Original strand, 153265 - 153497
Alignment:
| Q |
13 |
caaaggttgagatataccaatatgttgttctgaagtggacccttgcacttcttattggtttaattacaggacttgttgggttctttaataaccttggagt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
153265 |
caaaggttgagatataccaatatgttgttctgaagtggacccttgcacttcttattggtttaattacaggacttgttgggttctttaataaccttggagt |
153364 |
T |
 |
| Q |
113 |
tgagaatattgctggtttcaaacttctactcaccaacaatctcatgctcaagcaaaagtaccatgaggcatttgcagtgtacgttggttgtaacatgatt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
153365 |
tgagaatattgctggtttcaaacttctactcaccaacaatctcatgctcaagcaaaagtaccatgaggcatttgcagtgtacgttggttgtaacatgatt |
153464 |
T |
 |
| Q |
213 |
ttaggggttggtgctgcagccctgtgtgcttac |
245 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
153465 |
ttaggggttggtgcggcagccctgtgtgcttac |
153497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 55 - 160
Target Start/End: Complemental strand, 56471667 - 56471562
Alignment:
| Q |
55 |
ttgcacttcttattggtttaattacaggacttgttgggttctttaataaccttggagttgagaatattgctggtttcaaacttctactcaccaacaatct |
154 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||| | ||||| |||||| |||| ||||||||||||||||||||||| ||||| ||||||||| |||| |
|
|
| T |
56471667 |
ttgcacttcttattggtttaggcacaggtcttgtcgccttcttcaataacattggtgttgagaatattgctggtttcaagcttctcctcaccaaccatct |
56471568 |
T |
 |
| Q |
155 |
catgct |
160 |
Q |
| |
|
|||||| |
|
|
| T |
56471567 |
catgct |
56471562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University