View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18277_low_15 (Length: 328)
Name: NF18277_low_15
Description: NF18277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18277_low_15 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 30 - 328
Target Start/End: Original strand, 43526806 - 43527099
Alignment:
| Q |
30 |
gggtcaataagttgacccggccggtttaatataacatccggttcgccgatttaatccggatcttgccggattaaactggtccataacgggttgataacat |
129 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43526806 |
gggtcaataagatgagtcggccggtttaatataacatccggttcgccgatttaatccggatcttgccggattaaactggtccataacgggttgataacat |
43526905 |
T |
 |
| Q |
130 |
aaccgatctgatcactaaatggaaccggttaaccatccggtttccgattggactggttcgaccggctgatcaggtttttaaaaatatgcttcgagactcc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
43526906 |
aaccgatctgatcactaaatggaaccggttaaccatccggttcccgattggact---------ggctgatccggtttttaaaaatatgcttcaagactcc |
43526996 |
T |
 |
| Q |
230 |
atctattgtcttaattacttcatgttgtaggaatgaagtgtg----gcttgattaaaggttcagatggacaacatgaacataaagcaacacttgacattt |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43526997 |
atctattgtcttaattacttcatgttgtaggaatgaagtgtggctagcttgattaaaggttcagatggacaacatgaacataaagcaacacttgacattt |
43527096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University