View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18277_low_21 (Length: 239)
Name: NF18277_low_21
Description: NF18277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18277_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 13 - 223
Target Start/End: Complemental strand, 33089841 - 33089631
Alignment:
| Q |
13 |
aaaattgaaaccaaacccaattcaacaaacctctccaaaatcacttttttactctttgatgagtaaaccaaatgaaaaattgttgataaacatgcttttg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33089841 |
aaaattgaaaccaaacccaattcaacaaacctctccaaaatcacttttttactctttgatgagtaaaccaaatgaaaaattgttgataaacatgcttttg |
33089742 |
T |
 |
| Q |
113 |
tagaagcactcccaatctcaacattaaccttaaccatgttgaccaaagattcaacaatcccttcaatttttgccaatgactcaacattcatttccttaag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33089741 |
tagaagcactcccaatctcaacattaaccttaaccatgttgaccaaagattcaacaatcccttcaatttttgccaatgactcaacattcatttccttaag |
33089642 |
T |
 |
| Q |
213 |
caacaaagaag |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
33089641 |
caacaaagaag |
33089631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University