View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18277_low_22 (Length: 213)
Name: NF18277_low_22
Description: NF18277
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18277_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 13 - 199
Target Start/End: Complemental strand, 35203452 - 35203266
Alignment:
| Q |
13 |
ccaatgtaagtaaaccaaacccaattgaccccaaatgnnnnnnnnnnnnnnnngcagcatttttcagcaatagaagcctaatagagctaaagaaaaagac |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35203452 |
ccaatgtaagtaaaccaaacccaattgaccccaaatgaaaataaaaaacaaaagcagcatttttcagcaatagaagcctaatagagctaaagaaaaagac |
35203353 |
T |
 |
| Q |
113 |
ctcaaagagatagctagatagtttgaaaacgatgcttcatgttgatttctagatcagagaagtaactgaattatgaccaatattatt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35203352 |
ctcaaagagatagctagatagtttgaaaacgatgcttcatgttgatttctagatcagagaagtaactgaattatgaccaatattatt |
35203266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University