View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18278_high_59 (Length: 252)
Name: NF18278_high_59
Description: NF18278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18278_high_59 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 112 - 241
Target Start/End: Complemental strand, 39386067 - 39385938
Alignment:
| Q |
112 |
tgttctcactccttaatttgtgcttttgcatagatggaagttgtggcatgcggtgactactggaatggtaagagcaaaaattaagcatactattccatca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39386067 |
tgttctcactccttaatttgtgcttttgcatagatggaagttgtggcatgcggtgactactggaatggtaagagcaaaaattaagcatactattccatca |
39385968 |
T |
 |
| Q |
212 |
acaaaaagttaaccatactctcccattcat |
241 |
Q |
| |
|
||||||||| |||||||||||||||||||| |
|
|
| T |
39385967 |
acaaaaagtaaaccatactctcccattcat |
39385938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 4 - 55
Target Start/End: Complemental strand, 39386179 - 39386128
Alignment:
| Q |
4 |
gttgaaaatcgttggaaggtaaaaattgaacattataaaattctgtttccct |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39386179 |
gttgaaaatcgttggaaggtaaaaattgaacattataaaattctgtttccct |
39386128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University