View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18278_high_69 (Length: 238)
Name: NF18278_high_69
Description: NF18278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18278_high_69 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 27866574 - 27866344
Alignment:
| Q |
1 |
atatagttctgtctaagtaaatgctccattattcagaggaccacaaaatcacactcacacgctaagacattgtaatgtatggtacagaaatgaatcacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27866574 |
atatagttctgtctaagtaaatgctccattattcacaggaccacaaa-tcacactcacacgctaagacattgtaatgtatggtacagaaatgaatcacaa |
27866476 |
T |
|
| Q |
101 |
atttgaattgtactacgagctaataaattttcaggcaagccctgttctagttaggagctatagctcttgacctacgccgtatgtagtatgtactataatt |
200 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
27866475 |
atttgaattgtactacgaactaataaattttcaggtaagccctgttctagttaggagctatagctcatgaccaacgccgtatgtagtatgtactataatt |
27866376 |
T |
|
| Q |
201 |
ccacattatcgtttgaataattcaaatgaatt |
232 |
Q |
| |
|
|||||||||||||| |||||||||| |||||| |
|
|
| T |
27866375 |
ccacattatcgtttaaataattcaactgaatt |
27866344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University