View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18278_high_80 (Length: 211)
Name: NF18278_high_80
Description: NF18278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18278_high_80 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 17 - 138
Target Start/End: Original strand, 45747325 - 45747446
Alignment:
| Q |
17 |
aagattgagcatacagttgagaagaaagtagatggattttgcattgaactagaaaagggtatagaaatatcagtgacaagtcttgcaaccttacaggaac |
116 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45747325 |
aagattaagcatacagttgagaagaaagtagatggattttgcattgaactagaaaagggtatagaaatatcagtgacaagtcttgcaaccttacaggaac |
45747424 |
T |
 |
| Q |
117 |
tgttcacactctcaaaccccat |
138 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
45747425 |
tgttcacactctcaaaccccat |
45747446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 160 - 196
Target Start/End: Original strand, 45747470 - 45747506
Alignment:
| Q |
160 |
ctctcctaaaacttgtctgagaagaatactactctct |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45747470 |
ctctcctaaaacttgtctgagaagaatactactctct |
45747506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University