View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18278_low_40 (Length: 323)
Name: NF18278_low_40
Description: NF18278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18278_low_40 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 7e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 7 - 174
Target Start/End: Original strand, 26520901 - 26521068
Alignment:
| Q |
7 |
cagaacaatctcaaattcaaattgatttggaatataagatggagagaaacaaacccctttgaccatgttcatactaaccccacacctactgaaacgaaag |
106 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26520901 |
cagaacaatcccaaatccaaattgatttggaatataagatggagagaaacaaacccctttgaccatgttcatactaaccccacacctattgaaacgaaag |
26521000 |
T |
|
| Q |
107 |
cctttgtcgactctttgtattaaaggtcaacggtgaaaccatgacatcataattcataactcaacccc |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26521001 |
cctttgtcgactctttgtattaaaggtcaacggtgaaaccatgacatcataattcataactcaacccc |
26521068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 250 - 306
Target Start/End: Original strand, 26521145 - 26521201
Alignment:
| Q |
250 |
ggtatttatagagtcagggcatgtaaataccgtaaatatggtcaataggattatatg |
306 |
Q |
| |
|
|||||||| ||| ||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26521145 |
ggtatttacagaatcaggacatgtaaataccgtaaatatagtcaataggattatatg |
26521201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University