View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18278_low_48 (Length: 286)
Name: NF18278_low_48
Description: NF18278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18278_low_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 270
Target Start/End: Original strand, 24276947 - 24277216
Alignment:
| Q |
1 |
atttccagggagcaaccggttcaagaggcacatcatgtgggacaggtgttttcttgccacgtggtggagtcggtgcttttcagtcacatcagactaagag |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24276947 |
attttcagggagcaaccggttcaagaggcacatcatgtgggacaggtgttttcttgccacgtggtggagtcagtgcttttcagtcacatcagactaagag |
24277046 |
T |
 |
| Q |
101 |
acctggtatgcaacaaactaactatgtgatcttccccgtttaccaactttaatgtgtttacttttaatactgtgagtatggttttaaattgtggtccgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
24277047 |
acctggtatgcaacaaactaactatgtgatcttccccgtttaccgactttaatgtgtttacttttaatattgtaagtatggttttaaattgtggtccgca |
24277146 |
T |
 |
| Q |
201 |
atcgttaaatgacattattgctgcaatttaaaccacattggatgcaatttattgtaatgtacaaggtttg |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
24277147 |
atcgttaaatgacattattgctgcaatttaaaccacattggatgcaatttattgcaatgtacaaggtttg |
24277216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University