View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18278_low_49 (Length: 284)
Name: NF18278_low_49
Description: NF18278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18278_low_49 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 117 - 261
Target Start/End: Original strand, 1329719 - 1329863
Alignment:
| Q |
117 |
ttgtgcaaaccgagggtgatttgttgaacttaggagatgatagagtgacaactgaagaacatggggacaaacttgccttagctttatttgatggggctgc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1329719 |
ttgtgcaaaccgagggtgatttgttgaacttaggagatgatagagtgacaactgaagaacatggggacaaactagccttagctttatttgatggggctgc |
1329818 |
T |
 |
| Q |
217 |
accagcaacaagtgaaggtggaataaaagcacttccatggcatgc |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329819 |
accagcaacaagtgaaggtggaataaaagcacttccatggcatgc |
1329863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 1329603 - 1329669
Alignment:
| Q |
1 |
acccgaacctgaaccggaagaggatatgaatgaagtcaaggcccttccaccaccagaggaaccagcc |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1329603 |
acccgaacctgaaccggaagaggatatgaatgcagtcaaggcccttccaccaccagaggaaccagcc |
1329669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University