View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18278_low_60 (Length: 261)
Name: NF18278_low_60
Description: NF18278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18278_low_60 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 17 - 253
Target Start/End: Original strand, 12558848 - 12559084
Alignment:
| Q |
17 |
attccctttggggtaaagtcctacaannnnnnnnnaaagtaaaagtcattcaacttttacagtttgctcatgctctgccgatttgctaatgttaacaatg |
116 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12558848 |
attccctttggggtaaagtcctacaattttttttcaaagtaaaagtcattcaacttttacagtttgctcatgctctgccgatttgctaatgttaataatg |
12558947 |
T |
 |
| Q |
117 |
atcttttggctacctatacaaaatattttggtagatttgctatcnnnnnnnggattttcatgtgcgaaaagtattaaggaataacaattgtctacgtacg |
216 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
12558948 |
atcttttggctacctatgcaaaatattttggtagatttgctatcttttttaggattttcatgtgcgaaaagtatgaaggaataacaattgtctacttacg |
12559047 |
T |
 |
| Q |
217 |
ttaatcttagtttctgcatgttatcacaggttctgct |
253 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||| |
|
|
| T |
12559048 |
ttaatcttagtttctgcatgttatcatagtttctgct |
12559084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University