View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18278_low_61 (Length: 260)
Name: NF18278_low_61
Description: NF18278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18278_low_61 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 10 - 240
Target Start/End: Original strand, 38118870 - 38119100
Alignment:
| Q |
10 |
attatacttcaaaatgcaaacactatgaataaaaataatagtgagacacatccttggcatcttcatggacatgatttttgggtacttggatatggaaagg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38118870 |
attatacttcaaaatgcaaacactatgaataaaaataacagtgagacacatccttggcatcttcatggacatgatttttgggtacttggatatggaaagg |
38118969 |
T |
|
| Q |
110 |
gaaagtttgatgcgaacaaagacccaaaaaattataatttggtgaaccccattatgaagaatactgtgccagtgcactcatttggttggactgctttgag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38118970 |
gaaagtttgatgcgaacaaagacccaaaaaattataatttggtgaaccccattatgaagaatactgtgccagtgcactcatttggttggactgctttgag |
38119069 |
T |
|
| Q |
210 |
gtttcgatcagataatcctggtgtgtgggct |
240 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |
|
|
| T |
38119070 |
gtttcgatcagataatcctggtgtctgggct |
38119100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University