View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18278_low_65 (Length: 249)
Name: NF18278_low_65
Description: NF18278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18278_low_65 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 22 - 232
Target Start/End: Complemental strand, 43458176 - 43457966
Alignment:
| Q |
22 |
ttgaaccagggttgttcttctatcttttttgcttgatgtgaaatggtgctaatgaagcttatctttacatgattcatttcagaagaagtagcaatgcaga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43458176 |
ttgaaccagggttgttcttctatcttttttgcttgatgtgaaatggtgctaatgaagcttatctttacatgattcatttcagaagaagtagcaatgcaga |
43458077 |
T |
|
| Q |
122 |
gaatgggtagtagagataatccaacacttgagtcagccactggagttgctccaaagagaggaatggttcttccttttcaaccacttgcaatgtcttttga |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43458076 |
gaatgggtagtagagataatccaacacttgagtcagccactggagttgctccaaagagaggaatggttcttccttttcaaccacttgcaatgtcttttga |
43457977 |
T |
|
| Q |
222 |
tagtgttaatt |
232 |
Q |
| |
|
||||||||||| |
|
|
| T |
43457976 |
tagtgttaatt |
43457966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 178 - 232
Target Start/End: Original strand, 4500936 - 4500990
Alignment:
| Q |
178 |
agaggaatggttcttccttttcaaccacttgcaatgtcttttgatagtgttaatt |
232 |
Q |
| |
|
||||||||| |||| ||||| ||||||||||||||||| ||||| |||||||||| |
|
|
| T |
4500936 |
agaggaatgattctacctttccaaccacttgcaatgtcctttgagagtgttaatt |
4500990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University