View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18278_low_71 (Length: 241)
Name: NF18278_low_71
Description: NF18278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18278_low_71 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 8097806 - 8097564
Alignment:
| Q |
1 |
ttttcaaatgtggcattttttcaaaagtttggttctccttcttgcattagttgggtatctcttgtgcattatctaacgaagctactgcccatgttcaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8097806 |
ttttcaaatgtggcattttttcaaaagtttggttctccatcttgcattagttgggtatctcttgtgcattatctaacgaagctactgcccatgttcaaca |
8097707 |
T |
|
| Q |
101 |
attatgtgatctataggttcgtgctttaaaaccaagggggtgttttcaactcatttggttagctctcgtttagatgatttggaaggctcacaaca--ttt |
198 |
Q |
| |
|
||||||||| ||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| ||||| ||| |
|
|
| T |
8097706 |
attatgtgagctataggttcgtgctttgaaatcaagggggtgttttcaactcatttggttagctatcgtttagatgatttgaaaggctcgcaacattttt |
8097607 |
T |
|
| Q |
199 |
tannnnnnnnnccggcaacaaggacaataatattgattttgtt |
241 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| |
|
|
| T |
8097606 |
tttttctttttccggcaacaaggacaataatattgattttgtt |
8097564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University