View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18278_low_77 (Length: 232)
Name: NF18278_low_77
Description: NF18278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18278_low_77 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 14 - 214
Target Start/End: Original strand, 40979546 - 40979748
Alignment:
| Q |
14 |
cagaggaagaatctggcagacttaattaactcgtgaaattaatacactattacgattcagatttgaaatcaattaatcatcaatttcaagaacaccacca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40979546 |
cagaggaagaatctggcagacttaattaactcgtgaaattaatacactattacgattcagatttgaaatcaattaatcatcaatttcaagaacaccacca |
40979645 |
T |
 |
| Q |
114 |
caatgcaaactttgcaaaagtgattcttgactcatgaatcattatagtccttgaaag--aaannnnnnnnaacaggaatctatgtagcgtgccctgctct |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
40979646 |
caatgcaaactttgcaaaagtgattcttgactcatgaatcactatagtccttgaaagaaaaaaaaaaattaacaggaatctatgtagcgtgccctgctct |
40979745 |
T |
 |
| Q |
212 |
ttc |
214 |
Q |
| |
|
||| |
|
|
| T |
40979746 |
ttc |
40979748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University