View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18278_low_86 (Length: 211)
Name: NF18278_low_86
Description: NF18278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18278_low_86 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 42 - 188
Target Start/End: Complemental strand, 20517786 - 20517640
Alignment:
| Q |
42 |
tattgaccgatcaatctttggtaagagtgattaattaaattagtaataaatttggttggttaaaaattaaagaaatggaacattttgataagacgggtga |
141 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20517786 |
tattgaccgatcaatctttggtaagtgtgattaattaaattagtagtaaatttggttggttaaaaattaaagaaatggaacattttgataagacgggtga |
20517687 |
T |
 |
| Q |
142 |
gaattaatttgtgtgatgctttctttcttatctgtctctttcttccc |
188 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
20517686 |
gaattaatttgtgtgatgctgtctttcttatctgtctctttcttccc |
20517640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University