View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18278_low_9 (Length: 677)
Name: NF18278_low_9
Description: NF18278
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18278_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 2e-82; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 2e-82
Query Start/End: Original strand, 495 - 666
Target Start/End: Complemental strand, 17444441 - 17444270
Alignment:
| Q |
495 |
tatattttaatattgaattttacattttcaggtgaaatgcaccgaaaatagtgcatgctcaggaagtccagtgaatgtggtgataacagataattgccct |
594 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17444441 |
tatattttaatattaaatgttacattttcaggtgaaatgcaccgaaaatagtgcatgctcaggaagtccagtgaatgtggtgataacagataattgcccc |
17444342 |
T |
|
| Q |
595 |
gaatgtgaatctgcacattttgatttaagtggaactgcctttggttcccttgcaaatccaaaccaagctgat |
666 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17444341 |
gaatgtgaatctgcccattttgatttaagtggaactgcctttggttcccttgcaaatccaaaccaagctgat |
17444270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 518 - 651
Target Start/End: Complemental strand, 9630295 - 9630162
Alignment:
| Q |
518 |
attttcaggtgaaatgcaccgaaaatagtgcatgctcaggaagtccagtgaatgtggtgataacagataattgccctgaatgtgaatctgcacattttga |
617 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||| ||| |||| |||| |||| || |||| |||||||| ||||| | || || ||||| |
|
|
| T |
9630295 |
attttcaggtgaaatgcacagaaaatagtgcatgctcaagaaatcctgtgactgtgatgatcactgatagttgccctggatgtgcacctatccagtttga |
9630196 |
T |
|
| Q |
618 |
tttaagtggaactgcctttggttcccttgcaaat |
651 |
Q |
| |
|
| ||||||||||||| |||||||||||||||||| |
|
|
| T |
9630195 |
tctaagtggaactgcatttggttcccttgcaaat |
9630162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 101 - 178
Target Start/End: Complemental strand, 17444626 - 17444547
Alignment:
| Q |
101 |
ctggttacagatgatatacttatttataaaaataga----taataagaggtattttatgaaacagttttaagaaactaattt |
178 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17444626 |
ctggttacagatgata--cttgtttataaaaatagagagataataagaggtattttatgaaacagttttaagaaactaattt |
17444547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University