View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18279_high_19 (Length: 251)
Name: NF18279_high_19
Description: NF18279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18279_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 72 - 237
Target Start/End: Complemental strand, 43386260 - 43386098
Alignment:
| Q |
72 |
ctgaaagagagagattctgtgcactgggactgttgttgatcttatcaggtggttttgagaaacaacaaaatatttaatcaaatacttcttctttaaatta |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43386260 |
ctgaaagagagagattctgtgcactgggactgttg---atcttatcaggtggtgttgagaaacaacaaaatatttaatcaaatacttcttctttaaatta |
43386164 |
T |
 |
| Q |
172 |
ttaagttaattaaagatgtgctcatatacatgcaggaactactacaagtgttcaggtgaaagatgt |
237 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43386163 |
ttaagttaattaaagatgtgctgatatacatgcaggaactactacaagtgttcaggtgaaagatgt |
43386098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 43386331 - 43386290
Alignment:
| Q |
1 |
aggtagctagtcccccgtaaataatggcacttttgcattatt |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43386331 |
aggtagctagtcccccgtaaataatggcacttttgcattatt |
43386290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University