View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18279_high_29 (Length: 213)

Name: NF18279_high_29
Description: NF18279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18279_high_29
NF18279_high_29
[»] chr1 (1 HSPs)
chr1 (18-198)||(6635215-6635395)


Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 18 - 198
Target Start/End: Complemental strand, 6635395 - 6635215
Alignment:
18 atgcagttttggcagcaccagagtattgcaatgcaaatttcacattttacttcacaccaacattttggtccaacccatctttgtctttaacattcacgaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
6635395 atgcagttttggcagcaccagagtattgcaatgcaaatttcacattttacttcacaccaacattttggtccaacccatctttgtctttaacattcgcgaa 6635296  T
118 tcgaaaagcttgttactttaataccggggttatggtaattgatctagaaaaatggcgcgacggagattacacaacaaagat 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6635295 tcgaaaagcttgttactttaataccggggttatggtaattgatctagaaaaatggcgcgacggagattacacaacaaagat 6635215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University