View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18279_low_14 (Length: 306)

Name: NF18279_low_14
Description: NF18279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18279_low_14
NF18279_low_14
[»] chr2 (1 HSPs)
chr2 (15-81)||(31680465-31680531)


Alignment Details
Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 15 - 81
Target Start/End: Original strand, 31680465 - 31680531
Alignment:
15 gaaggaaaaaatttaagtgaaacctatagttcctaagaggatcattgactcaaaattacatcggact 81  Q
    ||||||||||||||||||||||||||  |||||||| ||||||||||||||||||||||||||||||    
31680465 gaaggaaaaaatttaagtgaaacctacggttcctaaaaggatcattgactcaaaattacatcggact 31680531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University