View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18279_low_17 (Length: 272)
Name: NF18279_low_17
Description: NF18279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18279_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 9e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 65 - 261
Target Start/End: Complemental strand, 33272161 - 33271964
Alignment:
| Q |
65 |
tccatttttccatttttgtcacgaactaacatctgaaattagttcgtcaatcaattaatctccctatcatctacttgattcaaacttttatgannnnnnn |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33272161 |
tccatttttccatttttgtcacgaactaacatctgaaattagttcgtcaatcaattaatctccctatcatctacttgattcaaacttttatgattttttt |
33272062 |
T |
 |
| Q |
165 |
aagagccaaaacttcgatgatttgatatgttgttatggatatgcttatatgtagcaagnnnnnnncatatagtatttggtttagaa-ttttgttcatc |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
33272061 |
aagagccaaaacttcgatgatttgatatgttgttttggatatgcttatatgtagcaagtttttttcatatagtatttggtttagaagttttgttcatc |
33271964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University