View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18279_low_20 (Length: 265)
Name: NF18279_low_20
Description: NF18279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18279_low_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 5612436 - 5612648
Alignment:
| Q |
1 |
tcttatgtcatgattaatcataaggtcataaccatactaaacacactgaaatttttcatggtatttttaattgtcatattgacatactttcatgatttta |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5612436 |
tcttatgtcatgattaatcataagttcataaccatactaaacacactgaaatttttcatggtatttttaattgtcatattgacatactttcatgatttta |
5612535 |
T |
 |
| Q |
101 |
attagttgttttttccaacaatgaaaaagaaaacttccagctctaaatcgatatatgttggttttaaaaacattatttctatcaagtgtgaagtgccctt |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
5612536 |
attaattgttttttccaacaatgaaaaagaaaacttccagctctaaatcgatatatgttggttttaaaaatattatttctatcaagtgtgatgtgccctt |
5612635 |
T |
 |
| Q |
201 |
tatttgatagtaa |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5612636 |
tatttgatagtaa |
5612648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University