View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18279_low_22 (Length: 251)

Name: NF18279_low_22
Description: NF18279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18279_low_22
NF18279_low_22
[»] chr3 (2 HSPs)
chr3 (72-237)||(43386098-43386260)
chr3 (1-42)||(43386290-43386331)


Alignment Details
Target: chr3 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 72 - 237
Target Start/End: Complemental strand, 43386260 - 43386098
Alignment:
72 ctgaaagagagagattctgtgcactgggactgttgttgatcttatcaggtggttttgagaaacaacaaaatatttaatcaaatacttcttctttaaatta 171  Q
    |||||||||||||||||||||||||||||||||||   ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
43386260 ctgaaagagagagattctgtgcactgggactgttg---atcttatcaggtggtgttgagaaacaacaaaatatttaatcaaatacttcttctttaaatta 43386164  T
172 ttaagttaattaaagatgtgctcatatacatgcaggaactactacaagtgttcaggtgaaagatgt 237  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
43386163 ttaagttaattaaagatgtgctgatatacatgcaggaactactacaagtgttcaggtgaaagatgt 43386098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 43386331 - 43386290
Alignment:
1 aggtagctagtcccccgtaaataatggcacttttgcattatt 42  Q
    ||||||||||||||||||||||||||||||||||||||||||    
43386331 aggtagctagtcccccgtaaataatggcacttttgcattatt 43386290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University