View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18279_low_24 (Length: 240)
Name: NF18279_low_24
Description: NF18279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18279_low_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 220
Target Start/End: Original strand, 16204978 - 16205180
Alignment:
| Q |
18 |
cctggtgcatgaggatcttcaaccaaatcaaccttaggttgcacaattgttatctcttccctaacaattgttgttctagctggtttaacaactaatactc |
117 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16204978 |
cctggtgcatgaggatcttccaccaaatcaaccttaggttgcacaattgttatctcttccctaacaattgttgttctagttggtttaacaactaatactc |
16205077 |
T |
 |
| Q |
118 |
ttggctcatgatcatgtccttctcccatgatacttgtgcctccaaaattcactccttgcccttgtggtgtcacatttctagctggagcactgtcatatac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16205078 |
ttggctcatgatcatgtccttctcccatgatacttgtgcctccaaaattcactccttgcccttgtggtgtcacatttctagctggagcactgtcatatac |
16205177 |
T |
 |
| Q |
218 |
tgc |
220 |
Q |
| |
|
||| |
|
|
| T |
16205178 |
tgc |
16205180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University