View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18279_low_30 (Length: 214)
Name: NF18279_low_30
Description: NF18279
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18279_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 17 - 198
Target Start/End: Original strand, 3719649 - 3719828
Alignment:
| Q |
17 |
aatatgttagatacgagggagagacattaatgttatagttccttctaaagtcttaaggcaatgaaaatacgagttacttttcttatatatcattatcatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3719649 |
aatatgttagatacgagggagagacattgatgctatagttccttctaaagtcttaaggcaatgaaaatacgagttacttttcttata------tatcatt |
3719742 |
T |
 |
| Q |
117 |
tattttatttacttatagttaatacgagattaaaccacttgcacttgaatat----gaacggtgtgagtatccaaatgattatatt |
198 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3719743 |
tattttatttacttatagttaatatgagattaaaccacttgcacttgaatatgaacgaacggtgtgagtatccaaatgattatatt |
3719828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University