View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18280_high_9 (Length: 210)
Name: NF18280_high_9
Description: NF18280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18280_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 26 - 55
Target Start/End: Original strand, 48708592 - 48708621
Alignment:
| Q |
26 |
tgtgagaaaagtccattatacccctttcac |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
48708592 |
tgtgagaaaagtccattatacccctttcac |
48708621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University