View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18280_low_11 (Length: 236)
Name: NF18280_low_11
Description: NF18280
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18280_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 44034743 - 44034873
Alignment:
| Q |
1 |
atgcacaacccgacgcccttaaataatttatggttcaaatgttatgagacagacatatgaaggatgtccatcaaattcatcgtctcatacgaagaattta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44034743 |
atgcacaacccgacgcccttaaataatttatggttcaaatgttatgagagagacatatgaaggatgtccatcaagttcatcgtctcatacgaagaattta |
44034842 |
T |
|
| Q |
101 |
caacctgcactttttaaaaacatagacatca |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44034843 |
caacctgcactttttaaaaacatagacatca |
44034873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University